A Minuscule Study of Global Warming on Acetobacter aceti-Elevated Temperature and Its Impact over the Industries
L. Krishnasamy and K. Jayanthi
Dept. of Biotechnology, Hindustan College of arts and science, Kellambakkam-603 103, Chennai, Tamil Nadu
*Corresponding Author E-mail: lksamy2004@yahoo.com, jayanthi_vijsan@yahoo.co.in
ABSTRACT:
The aim of this study was to investigate the effect elevated temperature on A. aceti which converts ethanol to acetic acid in the presence of oxygen. A.aceti was incubated at various temperatures like 37°C, 42°C, and 47°C for overnight. After exposure, the DNA content in each culture was determined. The results showed that an increase in temperature like 42°C and 47°C produced a marked decrease in the DNA content when compared to the culture incubated at 37°C. The expression of gene was confirmed using PCR. The PCR result showed that the gene citrate synthase of A.aceti was expressed in the culture incubated at 37°C and a significant suppression of the gene citrate synthase was seen in the culture treated at 42°C and 47°C.Therefore the elevated temperature on A.aceti will significantly affect the various importance of the organism especially in vinegar production where A.aceti plays a vital role.
KEYWORDS: A.aceti, elevated temperature, vinegar, citrate synthase gene
Acetobacter aceti is a benign microorganism that is ubiquitous in the environment, existing in alcoholic ecological niches such as flowers, fruits, honey bees, as well as in water and soil. It has a long history of safe use in the fermentation industry for the production of acetic acid from alcohol. There are no reports in the literature suggesting that A. aceti is a pathogen of humans or animals. It is also not considered a plant pathogen.
Acetic acid bacteria are defined within the family Acetobacteraceae and they are characterized by their ability to oxidize ethanol to acetic acid. Among AAB, Acetobacter strains are the major bacteria that are dealing with vinegar production industrially. A. aceti is considered a Class 1 Agent under the NIH Guidelines for Research Involving Recombinant DNA Molecules (U.S. Department of Health and Human Services), and is on the FDA's GRAS (generally recognized as safe) list of microorganisms. There are a number of applications for acetic acid. These include manufacturing of acetate rayon, plastics production, rubber production, and photographic chemicals. The most recent edition of Bergey's Manual of Systematic Bacteriology1 has reclassified the genus after a numerical analysis was conducted on 177 phenotypic characteristics of organisms in the genus.
Presently the genus consists of four species: A. aceti, A. liquefaciens (formerly A. aceti subsp. liquefaciens), and A. pasteurianus (formerly A. aceti subsp. xylinum and orleanensis), and A. hansenii.
Members of the genus Acetobacter have been used industrially since the 1850's. Acetobacter aceti is a Gram negative bacterium which is motile by peritrichous flagella. It is obligate aerobic possessing only the ability for respiratory metabolism with no fermentative ability. A. aceti does not form endospores. Acetate and lactate are oxidized to CO2 and H2O by the organism. The optimal temperature for growth is between 25 to 30⁰C and the pH optimum between 5.4 to 6.3.Acetic acid bacteria are used for industrial vinegar production because of their ability to oxidize ethanol and high resistance to acetic acid. The rate of production of acetic acid was greatly enhanced by a high cell density culture of Acetobacter aceti.Kinetic studies on a partially purified enzyme preparation show ATP to be an inhibitor of Citrate synthase. ATP inhibition is competitive with CoASAc but not oxaloacetate. The synthesis of Citrate synthase is sensitive to both anabolic and catabolic signals, once the enzyme is formed; its activity is regulated primarily by catabolic effectors.2
Acetic acid bacteria are used for industrial vinegar production because of their ability to oxidize ethanol and high resistance to acetic acid. The mechanism that confers acetic acid resistance has not been completely understood. Two proteins whose production was greatly enhanced by acetic acid in Acetobacter aceti were identified to be aconitase and a putative ABC-transporter.
Oxaloacetate +Acetyl-coA + H2O
CoA-SH + citrate
Overexpression or disruption of the genes encoding these proteins affected acetic acid resistance in A. aceti, indicating that these proteins are involved in acetic acid resistance. Over expression of each gene increased acetic acid resistance in Acetobacter, which resulted in an improvement in the productivity of acetic acid fermentation.3 Temperature - an important factor in regulating the growth of microorganisms. There are some organisms which are limited to growth when the temperature was above 37 °C. The influence of various temperture on the organisms was studied.
General features and mechanism of the enzyme
The enzyme citrate synthase exists in nearly all living cells & stands as a pace-making enzyme in the first step of the Citric Acid Cycle. Citrate synthase is localized within eukaryotic cells in the mitochondrial matrix, but is encoded by a nuclear DNA rather than mitochondrial. Citrate synthase is used as a quantitative enzyme marker for the presence of intact mitochondria. Citrate synthase catalyses the condensation reaction of the two-carbon acetate residue from acetyl coenzyme A & a molecule of four carbon acetate to form the six carbon citrate. Its activity is important for carbon assimilation and for energy generation.
Oxaloacetate is the first substrate to bind to the enzyme. This induces the enzyme to change its conformation,& creates a binding site for the acetyl-CoA. Only when this citroyl-CoA has formed will another conformational change cause thioester hydrolysis & release coenzyme A.Citrate Synthase has three key amino acids in its active site which catalyze the conversion of acetyl-CoA and oxaloacetate into citrate and H-SCoA in an aldol condensation reaction.
The key position of this enzyme within central metabolism has given rise to much interest in its structural, kinetic, regulatory and molecular characteristics and, therefore, it has been studied in great detail from a variety of different organisms Gram-negative bacteria have in general hexameric forms (M, - 250000) which are allosterically inhibited by NADH and, in facultative anaerobes, by 2-oxoglutarate. However, the subunits of both citrate synthase types are approximately the same size arAd in some regions display identity in their amino acid sequences.
As A. aceti being the major player of acetic acid production and as well commercially used in the synthesis of vinegar and wine production. The enzyme involved in this process Citrate synthase. The pH and the temperature optima for CS activity was about 7.5-8.0 and 40ș C, respectively. The citrate synthase was stable over a pH range of 6.0-8.5 and upto 40⁰C) 4. The rate of production of acetic acid was greatly enhanced by a high cell density culture of Acetobacter actei. 5The previous reports clearly stating that the increase in temperature does not hold any good for the enzyme; however there is no report at molecular level that, why the enzyme is inactive at elevated temperature. Hence the present investigation is designed to analyze the expression pattern of the citrate synthase enzyme under elevated temperature.
MATERIALS AND METHOD:
Bacterial culture
Acetobacter acetii have been selected for the present study which is obtained from NCIMB, Puna, India. The ATCC number is 23746. (Fig 1)
Fig.1 The Acetobacter acetii slant purchased from NCIMB
Inoculum Preparation and growth condition
The starter culture was prepared in the media containing yeast extract (1g/ml), tryptone (1g/ml), mannitol (25 g/ml). CaCo3 (1g/ml).The pH maintained at 6. The media was autoclaved at 121șC for 15 min. The prepared media was allowed to cool. Then a loop full of culture was taken and mixed in the broth. The culture broth was incubated at various temperatures like 37șC, 42 ș, 47 șC for overnight. (Fig 2)
DNA extraction
1ml of bacterial culture was taken. Centrifugation was carried out for 5 mins at 10,000rpm.the pellet was resuspended with 300”l STET buffer (8% Sucrose, 5% Triton X-100, 50mM EDTA, 50mM Tris pH 8.0). Then 30”l of RNase/lysozyme (5mg/ml stock, 20mg/ml stock) was added. Then the mixture was boiled for 1 min 15 sec. Centrifugation was carried out for 15 mins at 10,000rpm. The supernatent of the flow through was transferred to a 1.5 ml eppendorf. To the supernatent phenol extract with 150 ”l STET saturated phenol was added. Then the content was spin down and the supernatent of the flow through was collected. Then 0.6volume isoproponal was added and incubated at RT for 5 min. Centrifugation was carried out for 10 mins at 10,000rpm.The invisible pellet was washed with 70% ethanol. Then the pellet was resuspended with 50”l of TE buffer. (Then the DNA was resolved on 0.7% agarose gel, stained with Etheidum bromide and visualized on UV-transilluminator.)The DNA was stored at − 20 °C.
Quantification of DNA
0.5”l TE buffer was pipetted directly onto the Nanovue sample plate which act as a blank.Then0.5”l of sample was pipetted onto the Nanovue sample plate and quantified. The purity and concentration were viewed in the display.
Primer selection
The DNA isolated from the Acetobacter acetii was assessed by PCR amplification of the citrate synthase gene. Oligonucleotide primers used to amplify citrate synthase gene was designed using the primer3 site. (Fig 3)The accession number of the citrate synthase gene sequences was: (DQ631551).
Fig.2 The Acetobacter acetii treated at various temperature
Fig. 3 Primer3 site for designing the primer
The sequences of primers were
Left primer : CATTGTACGCAACGAATGACC Right primer: GGGAGACAGGAAGATGGACA
The primer pair amplifies a 402 base pair product. It was dissolved using 280”l of 1X sterile TE buffer.
PCR amplification of citrate synthase gene
PCR reactions were performed using a 28”l of PCR Platinum Super Mix (22U/ml complexed recombinant Taq DNA polymerase with platinum Taq antibody, 22 ml Tris Hcl(pH 8.4), 55mM Potassium chloride, 1.65 mM Magnesium chloride ; 220”M dGTP,220”M dATP, 220”M dTTP, 220”M dCTP, stabilizers,glycerol and blue tracking dye),0.9”l of isolated DNA sample and 0.7”l of each primers. PCR cycling conditions consisted of an initial denaturation at 94˚c for 4 minutes and amplified for 38 cycles a 94˚c for 30s, 58˚c for 1min and 72˚c for 1 min 30s. A final extension incubation of 10 min at 72˚c was included. (Fig 4)PCR products were viewed on a 2% agarose gel electrophoresis at 100v for 25 minutes. Transferred the gel to the ethidium bromide solution to stain for 20 minutes. After staining, gel was transferred twice to the distilled water in each to remove the excess stain and visualized for the band formation under UV transilluminator.
Fig. 4 PCR cycle condition
A. 37șC B. 42șC C. 47șC
Fig.5 The DNA of the culture sets C (a), T1 (b) and T2 (c) were quantified using Nano vue
RESULTS:
The three culture samples were taken and named as C (control), T1 (culture condition I) at 42 oC, T2 (culture condition II) at 47 oC
Quantification of Genomic DNA
The cultur conditions and designation are shown in the table 1.The genomic DNA of the culture sets C, T1 and T2 were isolated and quantified using Nanovue. The results of DNA quantification indicates that the genomic DNA content is gradually decreasing with the increase in temperature. The control shows the maximum amount of DNA when compared with that of the Culture T1 and Culture T2. (Fig 5).This significant finding clearly reveals that the rise in temperature has profound effect on DNA levels. The marked decrease in the DNA levels in culture T2 than Culture T1 with reference to the control signifies that at higher temperature the cellular system get collapsed and the organism couldnt maintain the integrity of the cellular mechanisms.
Table 1: Experimental setup and Culture conditions
|
S.No |
Culture condition and Designation |
Temperature (oC) |
Time Period of incubation |
|
1 |
C (control) |
37 |
overnight |
|
2 |
T1 (culture condition I) |
42 |
overnight |
|
3 |
T2 (culture condition II) |
47 |
overnight |
PCR Amplification and Gene Expression studies
With the isolated and quantified DNA sample the PCR was performed. The PCR product of the culture C was run on the agarose gel electrophoresis. The gene was expressed and the band formed. (Fig 6)With the same PCR condition the PCR product of the culture C, T1 and T2 were run on the agarose gel electrophoresis. The band densities of culture T1 and culture T2 are less when compared with that of the control culture C.(Fig 7)
Fig. 6 The expression of citrate synthase gene was observed in the control
Fig. 7 The expression of citrate synthase gene was observed in the control ,treated 1,treated 2 samples along with the marker on the both the sides.
DISCUSSION:
Acetobacter strain was isolated from coconut and used for the production of vinegar ,the report suggest that the isolated strain had grew at 25, 30 and 40° C (ref).And a new species of Acetobater, A. senegalensis, a thermotolerant Acetobacter that they isolated from mango (Mangifera indica L.)exhibited growth at 35° C as an optimum temperature 6 .For the production of vinegar honey is used along with a mixed AAB in room temperature, but no report or suggestion for the tolerance of the strains against high temperature.7The effects of pH and temperature on the enzyme activity and stability varies. Membrane-bound NAD(P)-independent formaldehyde- oxidizing enzyme was purified from the Acetobacter sp and their effect on ph and temperature was determined The optimum pH and temperature of the enzyme activity were found at pH 56 and 40 șC 8. The thermal stability of the enzyme was examined by measuring the enzyme activity after incubating FOE at various temperatures. The enzyme was stable up to 40șC, and enzyme activity decreased rapidly over 40șC 9.our results also support the same incidating that when there is increase in the temperature from 37șc to 42șc and 45ș c the expression of gene is inhibited as a result of if no protein production. The rise in temperature above 10oC to the optimum temperature, significantly alter the gene expression pattern which is confirmed by our PCR based studies. The extent of the DNA alteration entirely depends on the temperature increase as it is evident from the observation that there is more loss of DNA in the Culture T2 than the Culture T1 compared to that of the Culture C control. With this finding led us to conclude that the gene expression pattern of the enzyme is highly influenced by the temperature
CONCLUSION:
Global warming is an important issue in contemporary times. It affects the ecosystem to a large extent; it may be positive or adverse. The project carried out was a preliminary effort to show how the process of global warming affected the particular species ie. A.aceti. which was exposed to three different temperatures 37⁰C, 42⁰C, and 47⁰C.Due to elevation in the ambient temperature the DNAcontent in the species was affected drastically. The gene citrate synthase was also not expressed in the A.aceti incubated at the elevated temperature (42⁰C, 47⁰C).The present study reveals that the elevated temperature significantly affected the organism A. aceti. As a result of this effect the commercial importance of the A.aceti will be greatly reduced.
REFERENCES:
1. De Ley et al., In Bergey's Manual of Systematic Bacteriology,1,267-278 (1984).
2. R .Valerie, Flechtner, S.Richard, H. Hanson, Biochimica et Biophysica Acta (BBA).184,252-262(1969)
3. S.Nakano, M. Fukaya International Journal of Food Microbiology 125, 54-59 (2008)
4. Tomohide asai, Reiji Takahashi et al Journal of fermentation and bioengineering 79, 67-69 (1995)
5. S.P Yang, O.Hisao, F.Masahiro et al .Journal of fermentation and bioengineering.68, 96-101(1989)
6. B. Ndoye, L. Cleenwerck, K. Engelbeen, R. Dubois-Dauphin, A. T.Guiro, S. V. Trappen, A. Willems and P. Thonart, Int. J. Syst. Evol. Microbiol.57, 1576-1581. (2007)
7. E. C. IIha, E. S. Anna, R. C. Torres, A. C. Porto and E. M. Meinert, Acta Cie. Ven. 51,.231-235. (2000).
8. T. T. Kadere, T. Miamoto, R. K. Oniango, P. M. Kutima and S. M.Njoroge, Afr. J. Biotechnol.7,2963-2971(2008)
9. Matsushita, K., Toyama, H., and Adachi, O., Advances in Microbial Physiology, 36, 247301 (1994).
Received on 04.02.2012 Modified on 13.02.2012
Accepted on 18.03.2012 © AJRC All right reserved
Asian J. Research Chem. 5(4): April 2012; Page 477-482